Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.100253 |
Chromosome: | chromosome 16 |
Location: | 1147654 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650300 | HTR39,HTR25 | Histone H3; (1 of 35) K11253 - histone H3 (H3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTGCCGAACCCCACAGGTGTCGATGG |
Internal bar code: | GAATGACCCCGTCAGCACTTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 615 |
LEAP-Seq percent confirming: | 98.9468 |
LEAP-Seq n confirming: | 1691 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTCGAGGACACCAACCTGT |
Suggested primer 2: | CTCAGCACGCATGTAAGCAT |