| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.100363 |
| Chromosome: | chromosome 7 |
| Location: | 1692915 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325650 | (1 of 3) PF10601 - LITAF-like zinc ribbon domain (zf-LITAF-like) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTTCTGCCAAGGGTAGCCGGGGTCTGC |
| Internal bar code: | TACAAGTTTGACTTATTTTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1050 |
| LEAP-Seq percent confirming: | 99.5615 |
| LEAP-Seq n confirming: | 3860 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGAAACTGTCAGCGACAAC |
| Suggested primer 2: | TGAGATTTCATGGAGGAGGG |