| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.100616 |
| Chromosome: | chromosome 1 |
| Location: | 4380500 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029650 | VPS35 | (1 of 1) K18468 - vacuolar protein sorting-associated protein 35 (VPS35); Subunit of Retromer complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGGTTCGGCGAAAGACGACGGCGGTGT |
| Internal bar code: | AGCGATCGGTTCTAACGGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 398 |
| LEAP-Seq percent confirming: | 99.0873 |
| LEAP-Seq n confirming: | 4451 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCACAAGCTGTGACCAGT |
| Suggested primer 2: | GTCACACCTCATAGCCCGTT |