| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.100657 |
| Chromosome: | chromosome 10 |
| Location: | 5100796 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456150 | HLD3 | (1 of 1) PTHR10992:SF701 - SERINE HYDROLASE-RELATED; Haloalkane dehalogenase-like hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAACCGATCGTTTACATGCTACCCAAACG |
| Internal bar code: | GATCCGCCATGGTGTTCCCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 97.1499 |
| LEAP-Seq n confirming: | 1568 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCATGCAAGAAAGTGGCT |
| Suggested primer 2: | CGACACATCTGGACAACACC |