| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.100680 |
| Chromosome: | chromosome 12 |
| Location: | 3707960 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514650 | CNK6 | (1 of 1) PF10498//PF14531 - Intra-flagellar transport protein 57 (IFT57) // Kinase-like (Kinase-like); NIMA-related kinase 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCCGGCTGAAGAGGTGGCGAAGTTCGG |
| Internal bar code: | GTGACGATGGAACTCTAGGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 705 |
| LEAP-Seq percent confirming: | 98.8235 |
| LEAP-Seq n confirming: | 1848 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCCTTGGCTTCCTCTTG |
| Suggested primer 2: | CCATGTCCGAGTCCAGTTTT |