Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.100776 |
Chromosome: | chromosome 6 |
Location: | 7153761 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g297650 | UBC36 | (1 of 1) K10582 - ubiquitin-conjugating enzyme E2 Q (UBE2Q); E2 ubiquitin conjugating enzyme | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTACGCACCCACCCGCGCCCAACCCGCC |
Internal bar code: | CGGGGCCATTCTGATGGCCAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 511 |
LEAP-Seq percent confirming: | 49.7238 |
LEAP-Seq n confirming: | 360 |
LEAP-Seq n nonconfirming: | 364 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAGGAGAAAGCAACACGGG |
Suggested primer 2: | TCCTGACAACTTTGAAGGGC |