| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.100852 |
| Chromosome: | chromosome 1 |
| Location: | 4562010 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031100 | MET1,TEF30 | Thylakoid enriched fraction, 30-kDa protein; (1 of 3) PTHR17130//PTHR17130:SF24 - MITOCHONDRIAL OUTER MEMBRANE PROTEIN 25 // GAN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGCCAGCCGGCCCCAGCTTTATCCAGGC |
| Internal bar code: | TCATCGCAGAATCAATTGAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 98.7342 |
| LEAP-Seq n confirming: | 234 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACGCAATGCCTGAAGAGT |
| Suggested primer 2: | CTACTGAAGGACAGGGCAGC |