Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.100966 |
Chromosome: | chromosome 12 |
Location: | 5942170 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g534400 | (1 of 18) IPR011051 - RmlC-like cupin domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGCCAACGGCCACGCGGTACCTGCGCA |
Internal bar code: | GTTCATTTAGGTCACCCCTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1091 |
LEAP-Seq percent confirming: | 98.6755 |
LEAP-Seq n confirming: | 1043 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTTACAGCGACTTCAAGC |
Suggested primer 2: | GCCCTGATTGTAGCGTTGAT |