Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.100967 |
Chromosome: | chromosome 12 |
Location: | 2940219 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g501600 | BLZ8 | (1 of 6) PF07716 - Basic region leucine zipper (bZIP_2); bZIP transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAATGCGTCCAGCTACGTCGCCCTCGC |
Internal bar code: | TCTGGGTGGTTAGTAACTGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 528 |
LEAP-Seq percent confirming: | 99.0421 |
LEAP-Seq n confirming: | 4756 |
LEAP-Seq n nonconfirming: | 46 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCAGCCCCCTTAGATAGGC |
Suggested primer 2: | CGAGGGCGAGACTAGACAAC |