| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.101004 |
| Chromosome: | chromosome 13 |
| Location: | 4858426 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g605600 | OAS1 | (1 of 1) IPR018952//IPR026774 - 2'-5'-oligoadenylate synthetase 1, domain 2/C-terminal // 2'-5'-oligoadenylate synthase; 2'-5'-oligoadenylate synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATACATGCCCTTACATGCCTGTGCCGCG |
| Internal bar code: | CAACGATTATGAATTCGTGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 726 |
| LEAP-Seq percent confirming: | 99.2225 |
| LEAP-Seq n confirming: | 8168 |
| LEAP-Seq n nonconfirming: | 64 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTATCTGCCACGTAACGGT |
| Suggested primer 2: | ATATATCCCCATTCACCGCA |