Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.101022 |
Chromosome: | chromosome 11 |
Location: | 2135978 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g469500 | FXL6 | FixL-like PAS domain protein; (1 of 12) 2.7.13.3 - Histidine kinase / Protein kinase (histidine) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGACTGATCACGAGGTTCAGAACCCTTG |
Internal bar code: | CGGAGTGTTCAGTTAAGTCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 473 |
LEAP-Seq percent confirming: | 99.4768 |
LEAP-Seq n confirming: | 14070 |
LEAP-Seq n nonconfirming: | 74 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGATTTTCCTGTAGGCCA |
Suggested primer 2: | GACAGTGGGCAAAGGTTCAT |