Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.101034 |
Chromosome: | chromosome 8 |
Location: | 3696103 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g376740 | (1 of 1) IPR008979//IPR018392 - Galactose-binding domain-like // LysM domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTTAACACAGGCTTCCGGTGCTCCAAC |
Internal bar code: | TGGGACAAGACAGGGGCCGTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 63 |
LEAP-Seq percent confirming: | 70.9077 |
LEAP-Seq n confirming: | 953 |
LEAP-Seq n nonconfirming: | 391 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTGTGTCGCCTCAACCTTC |
Suggested primer 2: | GATGGCTGAAAGAAAGCCAG |