| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.101058 |
| Chromosome: | chromosome 1 |
| Location: | 7418402 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g053288 | (1 of 1) K01974 - RNA 3'-terminal phosphate cyclase (ATP) (RTCA, rtcA) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATTGCTTGGGCAGCGGACTGGTCGGGC |
| Internal bar code: | GGTTTGATAAATTTGTTTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 795 |
| LEAP-Seq percent confirming: | 99.1471 |
| LEAP-Seq n confirming: | 1860 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGAAGGAATTTGTGGAAT |
| Suggested primer 2: | ACAGTAACCCCCTGCCTCTT |