| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.101100 |
| Chromosome: | chromosome 14 |
| Location: | 490872 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611250 | POC9 | Proteome of centriole protein 9; (1 of 2) PTHR12086:SF9 - EF-HAND DOMAIN-CONTAINING PROTEIN 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCCTGACCCTGCAGAATACACAACCCGC |
| Internal bar code: | AAGAGATATCAGGAATAGTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 410 |
| LEAP-Seq percent confirming: | 97.1326 |
| LEAP-Seq n confirming: | 271 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGTGCCTGTCGCTAGTA |
| Suggested primer 2: | TGGATCAGTACTACGGTGCG |