| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.101160 |
| Chromosome: | chromosome 3 |
| Location: | 3647674 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g168800 | KIN4-1,KIN4A | (1 of 2) PTHR24115//PTHR24115:SF136 - FAMILY NOT NAMED // KLP31E, ISOFORM A; Kinesin motor protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTTAACCTGTCCTACCCCGCGACATAAC |
| Internal bar code: | GGATTCGTGATCGGGCTGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 146 |
| LEAP-Seq percent confirming: | 99.6234 |
| LEAP-Seq n confirming: | 529 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGGGCATGTTTAGGACG |
| Suggested primer 2: | AGGAGCAGCAAGAGGTCAAG |