| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.101296 |
| Chromosome: | chromosome 6 |
| Location: | 3973571 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278194 | FAP236 | (1 of 3) PF05217 - STOP protein (STOP); Flagellar Associated Protein 236 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCCCGGTCTGCCGAGGCATCCGGGCTG |
| Internal bar code: | CATGCTATGGCAGGTCTGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 811 |
| LEAP-Seq percent confirming: | 98.8257 |
| LEAP-Seq n confirming: | 1599 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGAAGCATGATGGGTTGA |
| Suggested primer 2: | ATGTAGGCACGTACCCAAGC |