| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.101377 |
| Chromosome: | chromosome 12 |
| Location: | 5896147 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533950 | COT1 | Cobalt transport protein; (1 of 1) PTHR33514//PTHR33514:SF3 - FAMILY NOT NAMED // PROTEIN ABCI12, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTAAACCATGGACATTCACAAAGCACAC |
| Internal bar code: | CGCGATGCGTTCCCCACCCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 698 |
| LEAP-Seq percent confirming: | 98.2949 |
| LEAP-Seq n confirming: | 4727 |
| LEAP-Seq n nonconfirming: | 82 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATCGATGACGACGACCTTG |
| Suggested primer 2: | ACGCTGCAGTGTTGGTAGTG |