| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.101392 |
| Chromosome: | chromosome 3 |
| Location: | 3724770 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g169550 | AOX2 | Alternative oxidase; (1 of 2) PTHR31803:SF3 - ALTERNATIVE OXIDASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAATGCCGCCGGGCGCATAGGGATAGGA |
| Internal bar code: | TAGGTGGTGTAAGCGTTCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 613 |
| LEAP-Seq percent confirming: | 99.2663 |
| LEAP-Seq n confirming: | 4600 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTTGGCCTGTACTTTCAT |
| Suggested primer 2: | GCTGTGAATCTGACAAGCGA |