Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.101423 |
Chromosome: | chromosome 3 |
Location: | 7869607 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g202600 | (1 of 38) IPR002048//IPR011992 - EF-hand domain // EF-hand domain pair | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACTAGCTCCAGAAACGGAACCGAAAGGA |
Internal bar code: | TCACACTACGGAGGCGGGGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 571 |
LEAP-Seq percent confirming: | 98.834 |
LEAP-Seq n confirming: | 1780 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTTAAAAACCGCCACATGC |
Suggested primer 2: | AGTACGCTACACGCGAGGTT |