Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.101471 |
Chromosome: | chromosome 17 |
Location: | 5966211 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g740430 | (1 of 1) IPR003663//IPR005828//IPR011701//IPR020846 - Sugar/inositol transporter // Major facilitator, sugar transporter-like // Major facilitator superfamily // Major facilitator superfamily domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGACTATCGCGTCGGCCTCCCTCACGA |
Internal bar code: | GGTTTGCTGCCGCGTCTTCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 333 |
LEAP-Seq percent confirming: | 98.9919 |
LEAP-Seq n confirming: | 491 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGTGGTAGCAGCAAGGAG |
Suggested primer 2: | GTGGTGGTATCGGAGCTGTT |