| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.101482 |
| Chromosome: | chromosome 14 |
| Location: | 3005871 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628050 | COG1 | Component of oligomeric golgi complex; (1 of 3) PF08700 - Vps51/Vps67 (Vps51) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTGCAGGGCTCTCGACGCTTGGAAAGAA |
| Internal bar code: | AGCCGGCGTATGCGTCGTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 99.3926 |
| LEAP-Seq n confirming: | 7855 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCATTCCAGAACCCAAAGC |
| Suggested primer 2: | TGTACCCTCCTGTACCCTGC |