| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.101501 |
| Chromosome: | chromosome 9 |
| Location: | 4204773 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394251 | PF16 | Central pair associated protein; (1 of 1) PF00514//PF13513 - Armadillo/beta-catenin-like repeat (Arm) // HEAT-like repeat (HEAT_EZ) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGGAGAACTGCTCGGGTCGCCATGTTG |
| Internal bar code: | ATGTTGCGGGCGAGGCGTCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 95.6452 |
| LEAP-Seq n confirming: | 593 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGCTTAGCGTCCTGGTT |
| Suggested primer 2: | ACAACTCGAAGTGGTTTGGG |