| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.101544 |
| Chromosome: | chromosome 2 |
| Location: | 342814 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075600 | (1 of 1) K10908 - DNA-directed RNA polymerase, mitochondrial [EC:2.7.7.6] (POLRMT, RPO41) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGCCGCCGCCGCCGCCTTGCCCATTGC |
| Internal bar code: | TATCATGCCCATACTGCGCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 296 |
| LEAP-Seq percent confirming: | 80.1887 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTAAACAGCAACACTCGCA |
| Suggested primer 2: | TGAGTGTTTCCCTCCCTTTG |