| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.101646 |
| Chromosome: | chromosome 16 |
| Location: | 1477179 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g652750 | FMO10 | Flavin-containing monooxygenase; (1 of 8) 1.14.13.8 - Flavin-containing monooxygenase / Ziegler's enzyme | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAAACGTGTTCCTGGGGGGCTTCGGCTC |
| Internal bar code: | CCAGTGGTACTCTACAGCTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 469 |
| LEAP-Seq percent confirming: | 99.6615 |
| LEAP-Seq n confirming: | 2061 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACAGCCCCTACAATGGG |
| Suggested primer 2: | TTCGCAGCCTGCTATATGTG |