| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.101689 |
| Chromosome: | chromosome 1 |
| Location: | 6651074 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g047700 | CYN40 | Cyclophilin 40; (1 of 2) K05864 - peptidyl-prolyl isomerase D [EC:5.2.1.8] (PPID, CYPD) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAAAGCACGGCAGCACCCACGGCGACAC |
| Internal bar code: | TTCGACAGTGCGGTGGGGTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 622 |
| LEAP-Seq percent confirming: | 78.4245 |
| LEAP-Seq n confirming: | 3126 |
| LEAP-Seq n nonconfirming: | 860 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGTGTGCAAAAAGGAGGG |
| Suggested primer 2: | CAAACACCCACACACACACA |