| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.101750 |
| Chromosome: | chromosome 16 |
| Location: | 3994925 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670550 | XPG3 | DNA repair 5'-3' exonuclease; (1 of 1) K15338 - flap endonuclease GEN [EC:3.1.-.-] (GEN1, GEN) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCGCTTGAGCGCCCGCCTATGCGTGTAG |
| Internal bar code: | GCGTGGAATCCAGGGACTCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 297 |
| LEAP-Seq percent confirming: | 32.5006 |
| LEAP-Seq n confirming: | 3942 |
| LEAP-Seq n nonconfirming: | 8187 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACTCACACTTGAGCGG |
| Suggested primer 2: | CTTTTCCCTAGCACCACTGC |