| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.101783 |
| Chromosome: | chromosome 3 |
| Location: | 5290206 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g183650 | GDP4,GDPD4 | (1 of 3) K01126 - glycerophosphoryl diester phosphodiesterase (E3.1.4.46, glpQ, ugpQ); Glycerophosphoryl diester phosphodiesterase family protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGACGGCGAGCAGGTGACGGGCGTGTTC |
| Internal bar code: | GCTAGGTCAATCCGTCTTCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 680 |
| LEAP-Seq percent confirming: | 3.44403 |
| LEAP-Seq n confirming: | 112 |
| LEAP-Seq n nonconfirming: | 3140 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGAAGGACTGCAGAAAC |
| Suggested primer 2: | ATCTGAGAGGAAATGGCACG |