Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.101948 |
Chromosome: | chromosome 1 |
Location: | 1501180 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g007737 | FBT1 | Folate/pteridine transporter 1; (1 of 1) IPR004324//IPR011701//IPR020846 - Folate-biopterin transporter // Major facilitator superfamily // Major facilitator superfamily domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTCAAGTCCTGGAACAGGCTCACGACCG |
Internal bar code: | ACGAGAACTATACATATCGACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 614 |
LEAP-Seq percent confirming: | 99.4675 |
LEAP-Seq n confirming: | 934 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCAGTCCAGCGCCTAAGTT |
Suggested primer 2: | CTCGCATAGCACTGGATGAA |