| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.101990 |
| Chromosome: | chromosome 7 |
| Location: | 5215455 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g348750 | (1 of 2) PTHR10794:SF58 - CAAX AMINO TERMINAL PROTEASE FAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCATGAAGGGATGCAGATGAGGCGCGG |
| Internal bar code: | GACGGAGGGTGTATCAACCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 700 |
| LEAP-Seq percent confirming: | 98.3621 |
| LEAP-Seq n confirming: | 2162 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAATCCTCCGAAACACAGG |
| Suggested primer 2: | GGCTCTCAAAACTCACTCCG |