Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.102203 |
Chromosome: | chromosome 7 |
Location: | 5806283 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g353300 | PXN1,MCP22 | Peroxisomal NAD+ carrier; (1 of 2) K13354 - solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17 (SLC25A17, PMP34) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGGCACCAGCGCGGCAGCCACCCACAC |
Internal bar code: | GGAATTGCCTGTCTGCGCTGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 665 |
LEAP-Seq percent confirming: | 98.9546 |
LEAP-Seq n confirming: | 9560 |
LEAP-Seq n nonconfirming: | 101 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCTCTATCCTCCACGCTG |
Suggested primer 2: | TAAAGATGCTGCAGACGGTG |