| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.102260 |
| Chromosome: | chromosome 1 |
| Location: | 4321347 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029250 | AAH1 | Aromatic amino acid hydroxylase-related protein; (1 of 1) PF00351 - Biopterin-dependent aromatic amino acid hydroxylase (Biopterin_H) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGCTCTGTCATCACTTAAGCCTGCCGCG |
| Internal bar code: | TCAGGGCCTATCGCAATAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 736 |
| LEAP-Seq percent confirming: | 99.2841 |
| LEAP-Seq n confirming: | 2219 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTTCGGTTCACCGTATTT |
| Suggested primer 2: | CTTCCAGAAGCGGTACTTCG |