| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.102334 |
| Chromosome: | chromosome 10 |
| Location: | 2628209 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g437350 | MCP12,MITC12 | Mitochondrial substrate carrier protein; (1 of 1) PF00153//PF13499 - Mitochondrial carrier protein (Mito_carr) // EF-hand domain pair (EF-hand_7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCACTAACTCACCCCATGGCGAGCCCT |
| Internal bar code: | TTAGCTTACTGCAGTTATCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 977 |
| LEAP-Seq percent confirming: | 97.4129 |
| LEAP-Seq n confirming: | 979 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATAACCATACATGCGGC |
| Suggested primer 2: | CTACCTAGCTTCGGAATGCG |