| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.102337 |
| Chromosome: | chromosome 5 |
| Location: | 2935595 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238250 | BLZ2,BZIP1 | (1 of 1) K04450 - cyclic AMP-dependent transcription factor ATF-2 (ATF2, CREBP1); Basic leucine zipper1 transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGTGTAGATTGTGTGGTCTGTTGGTCAG |
| Internal bar code: | TCAGTACACCGGAACGTGGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 364 |
| LEAP-Seq percent confirming: | 99.7815 |
| LEAP-Seq n confirming: | 14154 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTGACAGAATTTCCGGCT |
| Suggested primer 2: | CTCTTCGACCAGCTCCTGAC |