| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.102426 |
| Chromosome: | chromosome 16 |
| Location: | 1017336 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649100 | MAPKKK13 | (1 of 1) K04419 - mitogen-activated protein kinase kinase kinase 11 (MAP3K11, MLK3); Mitogen-Activated Protein Kinase Kinase Kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTTGGAATGTCGTTCACTGGTGCGTGCG |
| Internal bar code: | TGGCACGCGCATTTGGCATGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 869 |
| LEAP-Seq percent confirming: | 98.6863 |
| LEAP-Seq n confirming: | 8113 |
| LEAP-Seq n nonconfirming: | 108 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGCATGGTACCGTTATG |
| Suggested primer 2: | CAGGGACGTGGTACAGGACT |