Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.102719 |
Chromosome: | chromosome 3 |
Location: | 8204416 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g200000 | (1 of 2) PTHR10183//PTHR10183:SF323 - CALPAIN // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGCGGCAAGCGCTCGAGATTGGCGGGC |
Internal bar code: | TGTCGAGAGAGACTGTACGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1130 |
LEAP-Seq percent confirming: | 77.8846 |
LEAP-Seq n confirming: | 648 |
LEAP-Seq n nonconfirming: | 184 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAACCTCAACAGCCATCACC |
Suggested primer 2: | TTCTCCTGACGCAACATCTG |