| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.102724 |
| Chromosome: | chromosome 4 |
| Location: | 421870 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217920 | (1 of 41) PTHR32523//PTHR32523:SF8 - FAMILY NOT NAMED // PHYTOL KINASE 1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGTCTGCGATGGGGATCGAAGGCAAGG |
| Internal bar code: | CGTTCTGCGTGAGCCATGTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 641 |
| LEAP-Seq percent confirming: | 97.3734 |
| LEAP-Seq n confirming: | 2076 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGGTCACAGCATAGGAT |
| Suggested primer 2: | ATATTGTGGCGGCAAAAGTC |