Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.102746 |
Chromosome: | chromosome 3 |
Location: | 7320583 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g206750 | (1 of 1) IPR016040//IPR025659 - NAD(P)-binding domain // Tubby C-terminal-like domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTGGATGTGCTTGCTGAAAATGATGGTA |
Internal bar code: | GGATATGGCGTGAATACGCTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 747 |
LEAP-Seq percent confirming: | 99.1202 |
LEAP-Seq n confirming: | 338 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACGGCCTACGCAATCAAT |
Suggested primer 2: | GCTAGCACCACCCAACTAGC |