| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.102818 |
| Chromosome: | chromosome 10 |
| Location: | 5445773 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458550 | STIC2 | Chloroplast protein biogenesis factor; (1 of 1) PTHR33449:SF1 - NUCLEOID-ASSOCIATED PROTEIN YBAB | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATACGAGTGAATATGTGTGTGGACCTCA |
| Internal bar code: | GGCTGCATCGCAGCCGGGCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 474 |
| LEAP-Seq percent confirming: | 98.626 |
| LEAP-Seq n confirming: | 646 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCCCTTACAGCCCTGAGA |
| Suggested primer 2: | GCACGTGCTGAAATCTGTGT |