| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.102820 |
| Chromosome: | chromosome 16 |
| Location: | 1937010 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g656200 | (1 of 1) PF00612//PF13424 - IQ calmodulin-binding motif (IQ) // Tetratricopeptide repeat (TPR_12) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTCAGGGTGTGGCACCGTGACGGCACG |
| Internal bar code: | ACGCCAGGCGGAACGCACGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 764 |
| LEAP-Seq percent confirming: | 96.3652 |
| LEAP-Seq n confirming: | 1087 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAACTCTTGTGTGCTGCC |
| Suggested primer 2: | ACGGCGGTAAGGTACAGATG |