Insertion junction: LMJ.RY0402.102839_3

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.102839
Chromosome:chromosome_6
Location:1884162
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g263200 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ACCTAGCAGCCAAGTTTGCACCTGGGCCCA
Internal bar code:GTGAAGGGGCGGCTAGATGGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:643
LEAP-Seq percent confirming:99.2288
LEAP-Seq n confirming:772
LEAP-Seq n nonconfirming:6
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:AAACGTCGTAACCTGCCATC
Suggested primer 2:GATGGATGTTCTTCTGCGGT