| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.102899 |
| Chromosome: | chromosome 9 |
| Location: | 6588456 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g408350 | DeSI-5,DESI5 | DeSI-type SUMO protease; (1 of 15) 3.4.21.72 - IgA-specific serine endopeptidase / Immunoglobulin A1 protease | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCAAGGCGGCTTGGCTGCACGAGGTCT |
| Internal bar code: | TGCCGTGATGACAACGCGGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 631 |
| LEAP-Seq percent confirming: | 99.2735 |
| LEAP-Seq n confirming: | 2323 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTGGTATACATACGGCGG |
| Suggested primer 2: | ATTGGGCGTGTCTTACTTGG |