| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.102935 |
| Chromosome: | chromosome 2 |
| Location: | 6898808 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g119800 | (1 of 1) PF00097//PF00498 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4) // FHA domain (FHA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGCACCTGCGGACAAGGGCCTCCATGGT |
| Internal bar code: | GGATTTCGTAGACAAGCACTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 636 |
| LEAP-Seq percent confirming: | 92.1299 |
| LEAP-Seq n confirming: | 4027 |
| LEAP-Seq n nonconfirming: | 344 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTAACACGCTTGCCAGTTG |
| Suggested primer 2: | TATCTGGGGTACGCAGAAGG |