| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.103175 |
| Chromosome: | chromosome 5 |
| Location: | 622795 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g232002 | ACX2 | Acyl-CoA oxidase/dehydrogenase; (1 of 2) PTHR10909//PTHR10909:SF317 - ELECTRON TRANSPORT OXIDOREDUCTASE // ACYL-COENZYME A OXIDASE 2, PEROXISOMAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGAAAAGCGGTACAGGGGGGGGGGAGC |
| Internal bar code: | TAGGAATGAAAGTGGCAAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 425 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 5650 |
| LEAP-Seq n nonconfirming: | 226 |
| LEAP-Seq n unique pos: | 76 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAACATGCACCTGTTGTTG |
| Suggested primer 2: | AGCGTGTGGACACTAATCCC |