Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.103177 |
Chromosome: | chromosome 10 |
Location: | 3412019 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g444450 | SSA17 | cilia-sensing, structure and/or assembly; (1 of 1) K16462 - centrosomal protein CEP164 (CEP164) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGAGGACCTGAAGAGCGCTGCGACCTT |
Internal bar code: | TCCGTGCCTACTTTCATCACAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 48 |
LEAP-Seq percent confirming: | 98.5916 |
LEAP-Seq n confirming: | 70 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACATGTTGTCGGTGTCGG |
Suggested primer 2: | GTCTCTGGCCCTTGCTACAG |