| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.103226 |
| Chromosome: | scaffold 19 |
| Location: | 102031 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g750647 | (1 of 1) PF01636//PF07714 - Phosphotransferase enzyme family (APH) // Protein tyrosine kinase (Pkinase_Tyr) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGTTGCCATGGCAACGGCACTGCATATT |
| Internal bar code: | ATCAGACAGGGGAAGGCGGGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 29 |
| LEAP-Seq percent confirming: | 96.7742 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTGGTTTAGGCCGATTCA |
| Suggested primer 2: | AGGTCGCTTAATGCTCCTGA |