Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.103328 |
Chromosome: | chromosome 1 |
Location: | 3383694 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g021500 | (1 of 1) K15377 - solute carrier family 44 (choline transporter-like protein), member 2/4/5 (SLC44A2_4_5) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTTCCGTCTCGTAATGCCAAGCGACTT |
Internal bar code: | TACATTTAATCCGGCTAGCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 468 |
LEAP-Seq percent confirming: | 99.7302 |
LEAP-Seq n confirming: | 9611 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGCTGTCGTAGGTGCTCTT |
Suggested primer 2: | ACTTTGCCAACAACTGGGAC |