Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.103343 |
Chromosome: | chromosome 16 |
Location: | 1204438 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650800 | TIM13 | Mitochondrial inner membrane translocase subunit; (1 of 1) K17781 - mitochondrial import inner membrane translocase subunit TIM13 (TIM13) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGCAGCTGGTGGTTGCAGCCATAACAT |
Internal bar code: | GATGCCTTGGCATAGGGCCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 765 |
LEAP-Seq percent confirming: | 98.9011 |
LEAP-Seq n confirming: | 5580 |
LEAP-Seq n nonconfirming: | 62 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAATTACTCGCAAGCGTTGA |
Suggested primer 2: | TGCACCGACGTTCACATATT |