| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.103353 |
| Chromosome: | chromosome 11 |
| Location: | 3278254 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480060 | (1 of 1) K18327 - RNA exonuclease 4 [EC:3.1.-.-] (REXO4, REX4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGACAGGGGGAAGAAAGGGGTCTGGGTT |
| Internal bar code: | CTTGCGCAGACCAACACACGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 502 |
| LEAP-Seq percent confirming: | 99.6102 |
| LEAP-Seq n confirming: | 2811 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCTGTGGAACTTCTGGT |
| Suggested primer 2: | TCGGCTTAGCTTCACACCTT |