Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.103411 |
Chromosome: | chromosome 6 |
Location: | 5849344 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g287950 | SRH13 | (1 of 1) K10779//K10876 - transcriptional regulator ATRX [EC:3.6.4.12] (ATRX) // RAD54-like protein 2 [EC:3.6.4.12] (RAD54L2); SNF2-related DNA/RNA helicase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTCCGAGTGCTCCGGGCGGAGGGCGCG |
Internal bar code: | TCCGTCGCCCGTCGGGTGAAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 108 |
LEAP-Seq percent confirming: | 98.7915 |
LEAP-Seq n confirming: | 327 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCAGCTTTGTGAATTCTGG |
Suggested primer 2: | GAGATGCGCACTCACCATAA |