Insertion junction: LMJ.RY0402.103471_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.103471
Chromosome:chromosome_8
Location:4929985
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g385250 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AATCCAATCTGTAACGGCTGCAATCTGCCT
Internal bar code:CAGGCCGCAGGAGCACAGCGCC

Confirmation - LEAP-Seq

LEAP-Seq distance:868
LEAP-Seq percent confirming:99.0111
LEAP-Seq n confirming:801
LEAP-Seq n nonconfirming:8
LEAP-Seq n unique pos:16

Suggested primers for confirmation by PCR

Suggested primer 1:AACAGCAACAAATGCAGCAG
Suggested primer 2:GCTATGCGTTCATTCCGAAG